QTL-Seq Identified a Major QTL for Grain Length and Weight in Rice Using Near Isogenic F2 Population

doi:10.1016/j.rsci.2018.04.001

Abstract

Abstract:

Mapping and isolation of quantitative trait loci (QTLs) or genes controlling grain size or weight is very important to uncover the molecular mechanisms of seed development and crop breeding. To identify the QTLs controlling grain size and weight, we developed a near isogenic line F₂(NIL-F₂) population, which was derived from a residual heterozygous plant in an F₇ generation of recombinant inbred line (RIL). With the completion of more than 30× whole genome re-sequencing of the parents, two DNA bulks for large and small grains, a total of 58.94 Gb clean nucleotide data were generated. A total of 455 262 single nucleotide polymorphisms (SNPs) between the parents were identified to perform bulked QTL-seq. A candidate genomic region containing SNPs strongly associated with grain length and weight was identified from 15 to 20 Mb on chromosome 5. We designated the major QTL in the candidate region as qTGW5.3. Then, qTGW5.3 was further validated with PCR-based conventional QTL mapping method through developing simple sequence repeat and Insertion/Deletion markers in the F₂ population. Furthermore, recombinants and the progeny tests delimited the candidate region of qTGW5.3 to 1.13 Mb, flanked by HX5009 (15.15 Mb) and HX5003 (16.28 Mb). A set of NILs, selected from the F₂ population, was developed to evaluate the genetic effect of qTGW5.3. Significant QTL effects were detected on grain length, grain width and 1000-grain weight of H12-29 allele with 1.14 mm, -0.11 mm and 3.11 g, which explained 99.64%, 95.51% and 97.32% of the phenotypic variations, respectively.

Key words: grain length, grain weight, QTL-seq, quantitative trait locus, near-isogenic line, rice, single nucleotide polymorphism, recombinant inbred line, qTGW5.3

Yaobin Qin, Peng Cheng, Yichen Cheng, Yue Feng, Derun Huang, Tingxu Huang, Xianjun Song, Jiezheng Ying. QTL-Seq Identified a Major QTL for Grain Length and Weight in Rice Using Near Isogenic F₂ Population[J]. Rice Science, 2018, 25(3): 121-131.

Figures/Tables 9

Fig. 1. Morphological characteristics of the parents and F1 generations.Left, Female parent; Middle, Male parent; Right, F1. Bars in A and B are 20 cm whereas bars in C and D are 5 mm.

Fig. 2. Frequency distribution of grain trait performance in the NIL-F2 population and construction of two extremely bulks based on the segregation of grain length.

Table 1 Summary of the paired-end sequencing results.

Sample ^a	No. of raw reads	No. of clean reads	Raw base (Gb)	Clean base (Gb)	Percentage of high quality base ^b (%)	GC content (%)	Average depth	Genome coverage (%)
H12-29	127 306 420	123 917 740	15.91	15.23	98.33	43.47	40.02×	92.13
FH212	115 010 274	112 007 606	14.38	13.77	98.35	43.56	36.12×	91.89
L-bulk	121 555 464	117 864 724	15.19	14.48	98.30	43.77	37.85×	92.57
S-bulk	128 780 448	125 643 324	16.10	15.46	98.42	43.85	40.43×	92.50

Table 2 Number of single nucleotide polymorphisms (SNPs) and InDels detected in pools and parental lines.

Sample	No. of SNPs	No. of InDels
H12-29	3 525 128	421 211
FH212	3 539 142	415 224
L-bulk	3 620 518	425 506
S-bulk	3 627 828	428 012

Fig. 3. Distribution of 455 262 SNPs used in QTL-seq analysis on rice genome. Chr, Chromosome; SNP, Single nucleotide polymorphism. X-axis is the position of SNP on chromosome. Different colors represent the density of SNPs within a sliding window of 50 kb.

Fig. 4. Δ(SNP-index) graph for the whole genome was plotted by plotting the average Δ(SNP-index) using a sliding window of 1 Mb with a step of 10 kb. SNP, Single nucleotide polymorphism. Each spot represents a SNP, and X-axis corresponds to the position of rice genome. Red line is the average value of Δ(SNP-index). Δ(SNP-index) plot with the statistical confidence interval under the null hypothesis of no QTL (P < 0.05, blue line; P < 0.01, purple line). A significant region on chromosome 5 (black box) was identified for grain length and weight (15-20 Mb).

Fig. 5. Mapping of qTGW5.3. A to C, SNP-index graphs of L-bulk and S-bulk, and Δ(SNP-index) from QTL-seq analysis, respectively; D, Graphical genomic regions of the eight recombinants and the location of qTGW5.3 identified for grain length and weight. Chr, Chromosome.

Table 3 Sequences and physical location of the markers.

Marker	Physical position (bp) ^a		Forward primer	Reverse primer
HX5009	15 151 174-	15 151 528	AAACAAGAGCCAAAGAAGTCA	TTCCGCTACATCCAACAAATA
HX5022	15 580 256-	15 580 414	AACGCTCACCTACAGATT	GTAATGAACAGGCGAATT
HX5018	15 722 159-	15 722 347	TCAGCATCGGAACAAATC	GAAGGGACGGACAGAAAC
HX5003	16 285 064-	16 285 514	CTCAGGAAGGTAGTCCGAGTCAT	CACAAGCCGTCAAGTTTATCACA
HX5005	17 602 063-	17 602 197	GGCAATACCAATCTATCGCCTCT	GCTGGCACCATTATCAAAGTTCA
HX5008	19 224 457-	19 224 922	CGTTCAGGCTTGTCTTCTTCTTAC	AATCACGGCTCCACCTGTTATTT

Table 4 QTL analysis in near isogenic line (NIL) populations.

Trait	Homozygous genotypic groups (Mean ± SD)		P	A	R² (%)
Trait	NIL^H12-29	NIL^FH212	P	A	R² (%)
GL (mm)	8.98 ± 0.07	6.70 ± 0.07	< 0.0001	-1.14	99.64
GW (mm)	2.57 ± 0.02	2.79 ± 0.02	< 0.0001	0.11	95.51
TGW (g)	24.53 ± 0.49	18.30 ± 0.55	< 0.0001	-3.11	97.32
NPP	6.40 ± 0.90	6.00 ± 0.80	0.0457	-0.24	6.34
NGP	171.80 ± 16.90	182.10 ± 20.0	0.0191	5.12	7.27
NSP	191.90 ± 20.10	203.30 ± 16.90	0.006	5.72	8.85
GY (g)	27.13 ± 4.85	19.95 ± 3.89	< 0.0001	-3.59	40.65

References 38

[1]	Abe A, Kosugi S, Yoshida K, Natsume S, Takagi H, Kanzaki H, Matsumura H, Yoshida K, Mitsuoka C, Tamiru M, Innan H, Cano L, Kamoun S, Terauchi R.2012. Genome sequencing reveals agronomically important loci in rice using MutMap.Nat Biotechnol, 30: 174-178.
[2]	Austin R S, Vidaurre D, Stamatiou G, Breit R, Provart N J, Bonetta D, Zhang J, Fung P, Gong Y, Wang P W, McCourt P, Guttman D S.2011. Next-generation mapping ofArabidopsis genes. Plant J, 67(4): 715-725.
[3]	Bai X F, Wu B, Xing Y Z.2012. Yield-related QTLs and their applications in rice genetic improvement.J Integr Plant Biol, 54(5): 300-311.
[4]	Bhatia D, Wing R A, Yu Y, Chougule K, Kudrna D, Lee S, Rang A, Singh K.2018. Genotyping by sequencing of rice interspecific backcross inbred lines identifies QTLs for grain weight and grain length.Euphytica, 214: 41.
[5]	Chen X, Temnykh S, Xu Y, Cho Y G, McCouch S R.1997. Development of a microsatellite framework map providing genome-wide coverage in rice (Oryza sativa L.). Theor Appl Genet, 95(4): 553-567.
[6]	Cheng S H, Zhuang J Y, Fan Y Y, Du J H, Cao L Y.2007. Progress in research and development on hybrid rice: A super-domesticate in China.Ann Bot, 100(5): 959-966.
[7]	Daware A, Das S, Srivastava R, Badoni S, Singh A K, Agarwal P, Parida S K, Tyagi A K.2016. An efficient strategy combining SSR markers- and advanced QTL-seq-driven QTL mapping unravels candidate genes regulating grain weight in rice.Front Plant Sci, 7: 1535.
[8]	Duan P G, Xu J S, Zeng D L, Zhang B L, Geng M F, Zhang G Z, Huang K, Huang L J, Xu R, Ge S, Qian Q, Li Y H.2017. Natural variation in the promoter ofGSE5 contributes to grain size diversity in rice. Mol Plant, 10(5): 685-694.
[9]	Ehrenreich I M, Torabi N, Jia Y, Kent J, Martis S, Shapiro J A, Gresham D, Caudy A A, Kruglyak L.2010. Dissection of genetically complex traits with extremely large pools of yeast segregants.Nature, 464: 1039-1042.
[10]	Fang Y X, Wu W M, Zhang X Q, Jiang H, Lu W Y, Pan J J, Hu J, Guo L B, Zeng D L, Xue D W.2015. Identification of quantitative trait loci associated with tolerance to low potassium and related ions concentrations at seedling stage in rice (Oryza sativa L.). Plant Growth Regul, 77(2): 157-166.
[11]	Giovannoni J J, Wing R A, Ganal M W, Tanksley S D.1991. Isolation of molecular markers from specific chromosomal intervals using DNA pools from existing mapping populations.Nucl Acids Res, 19: 6553-6558.
[12]	Huang H X, Qian Q.2017. Progress in genetic research of rice grain shape and breeding achievements of long-grain shape and good qualityjaponica rice. Chin J Rice Sci, 31(6): 665-672. (in Chinese with English abstract)
[13]	Huang K, Wang D K, Duan P G, Zhang B L, Xu R, Li N, Li Y H.2017. WIDE AND THICK GRAIN 1, which encodes an otubain- like protease with deubiquitination activity, influences grain size and shape in rice.Plant J, 91(5): 849-860.
[14]	Illa-Berenguer E, van Houten J, Huang Z, van der Knaap E.2015. Rapid and reliable identification of tomato fruit weight and locule number loci by QTL-seq.Theor Appl Genet, 128(7): 1329-1342.
[15]	Li D Y, Huang Z Y, Song S H, Xin Y Y, Mao D H, Lv Q M, Zhou M, Tian D M, Tang M F, Wu Q, Liu X, Chen T T, Song X W, Fu X Q, Zhao B R, Liang C Z, Li A H, Liu G Z, Li S G, Hu S N, Cao X F, Yu J, Yuan L P, Chen C Y, Zhu L H.2016. Integrated analysis of phenome, genome, and transcriptome of hybrid rice uncovered multiple heterosis-related loci for yield increase.Proc Natl Acad Sci USA, 113: 6026-6035.
[16]	Li H, Durbin R.2009. Fast and accurate short read alignment with Burrows-Wheeler transform.Bioinformatics, 25: 1754-1760.
[17]	Li N, Li Y H.2016. Signaling pathways of seed size control in plants.Curr Opin Plant Biol, 33: 23-32.
[18]	Lu H F, Lin T, Klein J, Wang S H, Qi J J, Zhou Q, Sun J J, Zhang Z H, Weng Y Q, Huang S W.2014. QTL-seq identifies an early flowering QTL located near flowering locusT in cucumber. Theor Appl Genet, 127(7): 1491-1499.
[19]	Lu X, Xiong Q, Cheng T, Li Q T, Liu X L, Bi Y D, Li W, Zhang W K, Ma B, Lai Y C, Du W G, Man W Q, Chen S Y, Zhang J S.2017. APP2C-1 allele underlying a quantitative trait locus enhances soybean 100-seed weight. Mol Plant, 10(5): 670-684.
[20]	Michelmore R W, Paran I, Kesseli R V.1991. Identification of markers linked to disease-resistance genes by bulked segregant analysis: A rapid method to detect markers in specific genomic regions by using segregating populations.Proc Natl Acad Sci USA, 88: 9828-9832.
[21]	Murray M G, Thompson W F.1980. Rapid isolation of high molecular weight plant DNA.Nucl Acids Res, 8: 4321-4325.
[22]	Ogiso-Tanaka E, Tanaka T, Tanaka K, Nonoue Y, Sasaki T, Fushimi E, Koide Y, Okumoto Y, Yano M, Saito H.2017. Detection of novel QTLs qDTH4.5 and qDTH6.3, which confer late heading under short-day conditions, by SSR marker-based and QTL-seq analysis. Breeding Sci, 67: 101-109.
[23]	Schneeberger K, Ossowski S, Lanz C, Juul T, Petersen A H, Nielsen K L, Jorgensen J E, Weigel D, Andersen S U.2009. SHOREmap: Simultaneous mapping and mutation identification by deep sequencing.Nat Methods, 6(8): 550-551.
[24]	Schneeberger K, Weigel D.2011. Fast-forward genetics enabled by new sequencing technologies.Trends Plant Sci, 16(5): 282-288.
[25]	Shao G N, Tang S Q, Luo J, Jiao G A, Wei X J, Tang A, Wu J L, Zhuang J Y, Hu P S.2010. Mapping ofqGL7-2, a grain length QTL on chromosome 7 of rice. J Genet Genom, 37(8): 523-531.
[26]	Song X J, Kuroha T, Ayano M, Furuta T, Nagai K, Komeda N, Segami S, Miura K, Ogawa D, Kamura T, Suzuki T, Higashiyama T, Yamasaki M, Mori H, Inukai Y, Wu J, Kitano H, Sakakibara H, Jacobsen S E, Ashikari M.2015. Rare allele of a previously unidentified histone H4 acetyltransferase enhances grain weight, yield, and plant biomass in rice.Proc Natl Acad Sci USA, 112(1): 76-81.
[27]	Sun X W, Liu D Y, Zhang X F, Li W B, Liu H, Hong W G, Jiang C B, Guan N, Ma C X, Zeng H P, Xu C H, Song J, Huang L, Wang C M, Shi J J, Wang R, Zheng X H, Lu C Y, Wang X W, Zheng H K.2013. SLAF-seq: An efficient method of large-scale de novo SNP discovery and genotyping using high-throughput sequencing. PLoS One, 8: e58700.
[28]	Takagi H, Abe A, Yoshida K, Kosugi S, Natsume S, Mitsuoka C, Uemura A, Utsushi H, Tamiru M, Takuno S, Innan H, Cano L M, Kamoun S, Terauchi R.2013. QTL-seq: Rapid mapping of quantitative trait loci in rice by whole genome resequencing of DNA from two bulked populations.Plant J, 74(1): 174-183.
[29]	Wang S S, Wu K, Qian Q, Liu Q, Li Q, Pan Y J, Ye Y F, Liu X Y, Wang J, Zhang J Q, Li S, Wu Y J, Fu X D.2017. Non-canonical regulation of SPL transcription factors by a human OTUB1-like deubiquitinase defines a new plant type rice associated with higher grain yield. Cell Res, 27: 1142-1156.
[30]	Wang Y X, Xiong G S, Hu J, Jiang L, Yu H, Xu J, Fang Y X, Zeng L J, Xu E, Xu J, Ye W J, Meng X B, Liu R F, Chen H Q, Jing Y H, Wang Y H, Zhu X D, Li J Y, Qian Q.2015. Copy number variation at the GL7 locus contributes to grain size diversity in rice. Nat Genet, 47: 944-948.
[31]	Yamanaka N, Watanabe S, Toda K, Hayashi M, Fuchigami H, Takahashi R, Harada K.2005. Fine mapping of the FT1 locus for soybean flowering time using a residual heterozygous line derived from a recombinant inbred line. Theor Appl Genet, 110(4): 634-639.
[32]	Yan W H, Wang P, Chen H X, Zhou H J, Li Q P, Wang C R, Ding Z H, Zhang Y S, Yu S B, Xing Y Z, Zhang Q F.2011. A major QTL,Ghd8, plays pleiotropic roles in regulating grain productivity, plant height, and heading date in rice. Mol Plant, 4: 319-330.
[33]	Yi C D, Wang D R, Jiang W, Li W, Cheng X J, Wang Y, Zhou Y, Liang G H, Gu M H.2016. Development of functional markers and identification of haplotypes for rice grain width gene GS5. Chin J Rice Sci, 30(5): 487-492. (in Chinese with English abstract)
[34]	Ying J Z, Shan J X, Gao J P, Zhu M Z, Shi M, Lin H X.2012. Identification of quantitative trait loci for lipid metabolism in rice seeds.Mol Plant, 5(4): 865-875.
[35]	Yoon D B, Kang K H, Kim H J, Ju H G, Kwon S J, Suh J P, Jeong O Y, Ahn S N.2006. Mapping quantitative trait loci for yield components and morphological traits in an advanced backcross population between Oryza grandiglumis and the O. sativa japonica cultivar Hwaseongbyeo. Theor Appl Genet, 112: 1052-1062.
[36]	Yu J P, Xiong H Y, Zhu X Y, Zhang H L, Li H H, Miao J L, Wang W S, Tang Z S, Zhang Z Y, Yao G X, Zhang Q, Pan Y H, Wang X, Rashid M A R, Li J J, Gao Y M, Li Z K, Yang W C, Fu X D, Li Z C.2017. OsLG3 contributing to rice grain length and yield was mined by Ho-LAMap.BMC Biol, 15: 28.
[37]	Zhang Y, Luo L J, Xu C, Zhang Q F, Xing Y Z.2006. Quantitative trait loci for panicle size, heading date and plant height co- segregating in trait-performance derived near-isogenic lines of rice (Oryza sativa). Theor Appl Genet, 113(2): 361-368.
[38]	Zuo J R, Li J Y.2014. Molecular genetic dissection of quantitative trait loci regulating rice grain size.Annu Rev Genet, 48: 99-118.

QTL-Seq Identified a Major QTL for Grain Length and Weight in Rice Using Near Isogenic F₂ Population

RichHTML

PDF

Knowledge

Abstract

Cite this article

share this article

Figures/Tables 9

References 38

Related Articles 15

Recommended Articles

Metrics

[1]	Prathap V, Suresh KUMAR, Nand Lal MEENA, Chirag MAHESHWARI, Monika DALAL, Aruna TYAGI. Phosphorus Starvation Tolerance in Rice Through a Combined Physiological, Biochemical and Proteome Analysis [J]. Rice Science, 2023, 30(6): 8-.
[2]	Serena REGGI, Elisabetta ONELLI, Alessandra MOSCATELLI, Nadia STROPPA, Matteo Dell’ANNO, Kiril PERFANOV, Luciana ROSSI. Seed-Specific Expression of Apolipoprotein A-I_Milano Dimer in Rice Engineered Lines [J]. Rice Science, 2023, 30(6): 6-.
[3]	Sundus ZAFAR, XU Jianlong. Recent Advances to Enhance Nutritional Quality of Rice [J]. Rice Science, 2023, 30(6): 4-.
[4]	Kankunlanach KHAMPUANG, Nanthana CHAIWONG, Atilla YAZICI, Baris DEMIRER, Ismail CAKMAK, Chanakan PROM-U-THAI. Effect of Sulfur Fertilization on Productivity and Grain Zinc Yield of Rice Grown under Low and Adequate Soil Zinc Applications [J]. Rice Science, 2023, 30(6): 9-.
[5]	FAN Fengfeng, CAI Meng, LUO Xiong, LIU Manman, YUAN Huanran, CHENG Mingxing, Ayaz AHMAD, LI Nengwu, LI Shaoqing. Novel QTLs from Wild Rice Oryza longistaminata Confer Rice Strong Tolerance to High Temperature at Seedling Stage [J]. Rice Science, 2023, 30(6): 14-.
[6]	LIN Shaodan, YAO Yue, LI Jiayi, LI Xiaobin, MA Jie, WENG Haiyong, CHENG Zuxin, YE Dapeng. Application of UAV-Based Imaging and Deep Learning in Assessment of Rice Blast Resistance [J]. Rice Science, 2023, 30(6): 10-.
[7]	Md. Forshed DEWAN, Md. AHIDUZZAMAN, Md. Nahidul ISLAM, Habibul Bari SHOZIB. Potential Benefits of Bioactive Compounds of Traditional Rice Grown in South and South-East Asia: A Review [J]. Rice Science, 2023, 30(6): 5-.
[8]	Raja CHAKRABORTY, Pratap KALITA, Saikat SEN. Phenolic Profile, Antioxidant, Antihyperlipidemic and Cardiac Risk Preventive Effect of Chakhao Poireiton (A Pigmented Black Rice) in High-Fat High-Sugar induced Rats [J]. Rice Science, 2023, 30(6): 11-.
[9]	LI Qianlong, FENG Qi, WANG Heqin, KANG Yunhai, ZHANG Conghe, DU Ming, ZHANG Yunhu, WANG Hui, CHEN Jinjie, HAN Bin, FANG Yu, WANG Ahong. Genome-Wide Dissection of Quan 9311A Breeding Process and Application Advantages [J]. Rice Science, 2023, 30(6): 7-.
[10]	JI Dongling, XIAO Wenhui, SUN Zhiwei, LIU Lijun, GU Junfei, ZHANG Hao, Tom Matthew HARRISON, LIU Ke, WANG Zhiqin, WANG Weilu, YANG Jianchang. Translocation and Distribution of Carbon-Nitrogen in Relation to Rice Yield and Grain Quality as Affected by High Temperature at Early Panicle Initiation Stage [J]. Rice Science, 2023, 30(6): 12-.
[11]	Nazaratul Ashifa Abdullah Salim, Norlida Mat Daud, Julieta Griboff, Abdul Rahim Harun. Elemental Assessments in Paddy Soil for Geographical Traceability of Rice from Peninsular Malaysia [J]. Rice Science, 2023, 30(5): 486-498.
[12]	Tan Jingyi, Zhang Xiaobo, Shang Huihui, Li Panpan, Wang Zhonghao, Liao Xinwei, Xu Xia, Yang Shihua, Gong Junyi, Wu Jianli. ORYZA SATIVA SPOTTED-LEAF 41 (OsSPL41) Negatively Regulates Plant Immunity in Rice [J]. Rice Science, 2023, 30(5): 426-436.
[13]	Monica Ruffini Castiglione, Stefania Bottega, Carlo Sorce, Carmelina SpanÒ. Effects of Zinc Oxide Particles with Different Sizes on Root Development in Oryza sativa [J]. Rice Science, 2023, 30(5): 449-458.
[14]	Ammara Latif, Sun Ying, Pu Cuixia, Noman Ali. Rice Curled Its Leaves Either Adaxially or Abaxially to Combat Drought Stress [J]. Rice Science, 2023, 30(5): 405-416.
[15]	Liu Qiao, Qiu Linlin, Hua Yangguang, Li Jing, Pang Bo, Zhai Yufeng, Wang Dekai. LHD3 Encoding a J-Domain Protein Controls Heading Date in Rice [J]. Rice Science, 2023, 30(5): 437-448.